-Opioid Receptor Cell Surface Expression Is Regulated by Its Direct Interaction with Ribophorin I

The trafficking of the -opioid receptor (MOR), a member of the rhodopsin G protein-coupled receptor (GPCR) family, can be regulated by interaction with multiple cellular proteins. To determine the proteins involved in receptor trafficking, using the targeted proteomic approach and mass spectrometry analysis, we have identified that Ribophorin I (RPNI), a component of the oligosaccharide transferase complex, could directly interact with MOR. RPNI can be shown to participate in MOR export by the intracellular retention of the receptor after small interfering RNA knockdown of endogenous RPNI. Overexpression of RPNI rescued the surface expression of the MOR 344KFCTR348 deletion mutant independent of calnexin. Furthermore, RPNI regulation of MOR trafficking is dependent on the glycosylation state of the receptor, as reflected by the inability of overexpression of RPNI to affect the trafficking of the N-glycosylationdeficient mutants, or GPCRs that have minimal glycosylation sites. Hence, this novel RPNI chaperone activity is a consequence of N-glycosylation-dependent direct interaction with MOR. Being a member of the GPCR superfamily and rhodopsin subfamily, opioid receptors ( , , ) have the putative structures of seven-transmembrane domains and an extracellular N terminus with multiple glycosylation sites (Evans et al., 1992; Kieffer et al., 1992; Chen et al., 1993). When synthesis occurs, the completed core oligosaccharide is transferred from the dolichylpyrophosphate carrier to a growing, newly synthesized polypeptide chain, which is coupled through an N-glycosidic bond to the side chain of an asparagine residue. The oligosaccharyltransferase responsible for this transfer is a complex enzyme with its active site in the lumen of endoplasmic reticulum (ER) (Silberstein and Gilmore, 1996). During the translocation into the ER lumen, polypeptides on membrane-bound polysomes may be cotranslationally modified by N-glycosylation (Kreibich et al., 1983). In this process, the oligosaccharide transferase (OST) catalyzes the transfer of high mannose oligosaccharides, which are preassembled on lipid-anchored dolicholpyrophosphate moieties to an asparagine residue within an Asn-X-Ser/Thr consensus motif of nascent polypeptide chains facing the lumen of the ER (Abeijon and Hirschberg, 1992). Immediately after coupling to the polypeptide chain, terminal glucose and mannose residues are removed by ER glucosidases and mannosidases (Kornfeld and Kornfeld, 1985). When the glycoprotein moves to the Golgi complex, the glycan chains undergo further trimming of mannoses. N-glycosylation has been found to be an important factor in the regulation of protein folding, stability, sorting and secretion (Helenius and Aebi, 2001). For opioid receptors, this N-glycosylation is a rate-limiting step in their translocation to the cell membrane (Petaja-Repo et al., 2000). However, the detailed mechanism of the opioid receptors biosynthesis is still elusive. A truncated form (38–117) of GEC1 was found to specifically interact with the C-tail of the human -opioid receptor (KOR) and to be important for trafficking human KOR in the biosynthesis pathway (Chen et al., This work was supported by the National Institutes of Health National Institute on Drug Abuse [Grants DA007339, DA016674, DA000564, DA011806]. Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org. doi:10.1124/mol.108.054064. □S The online version of this article (available at http://molpharm. aspetjournals.org) contains supplemental material. ABBREVIATIONS: GPCR, G protein-coupled receptor; ER, endoplasmic reticulum; OST, oligosaccharide transferase; KOR, -opioid receptor; N2A, neuro2A neuroblastoma cell; RPNI, ribophorin I; MOR, -opioid receptor; DMEM, Dulbecco’s modified Eagle’s medium; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; siRNA, small interfering RNA; GFP, green fluorescent protein; AR, adrenergic receptor; HA, hemagglutinin; FACS, fluorescence activated cell sorting; LC MS/MS, liquid chromatography-tandem mass spectrometry; EndoH, endoglycosidase H; PNGase F, peptide-N -(N-acetyl-glucosaminyl)asparagine amidase; IP, immunoprecipitation; co-IP, coimmunoprecipitation; AR, adrenergic receptor; MOR5ND, MOR with Asn9, Asn31, Asn38, Asn46, and Asn53 residues at the N terminus all mutated to Asp; MG132, N-benzoyloxycarbonyl (Z)-Leu-Leu-leucinal; DOR, -opioid receptor; BiP, ER luminal binding protein; C2, MOR with the 344KFCTR348 sequence deleted. 0026-895X/09/7506-1307–1316$20.00 MOLECULAR PHARMACOLOGY Vol. 75, No. 6 Copyright © 2009 The American Society for Pharmacology and Experimental Therapeutics 54064/3474420 Mol Pharmacol 75:1307–1316, 2009 Printed in U.S.A. 1307 http://molpharm.aspetjournals.org/content/suppl/2009/03/16/mol.108.054064.DC1 Supplemental material to this article can be found at: at A PE T Jornals on Jne 3, 2017 m oharm .aspeurnals.org D ow nladed from 2006). Whether proteins similar to GEC1 participate in MOR maturation process remains unknown. To identify the binding partners of MOR, we purified the MOR complexes from neuroblastoma neuro2A (N2A) cells stably expressing (His)6-tagged MOR using Ni -resin affinity column chromatography. We found that ribophorin I (RPNI), a member of the oligosaccharide transferase family that was assumed to be responsible for N-glycosylation of newly synthesized proteins, could interact with MOR specifically. Furthermore, our results showed that RPNI was a critical mediator of the MOR transport from the ER to the cell membrane. Our data demonstrate that, in addition to N-glycosylation, RPNI acts as a novel key regulator in the transport of nascent receptors, thus affecting MOR function. Materials and Methods Expression of (His)6-MOR in the N2A Cells. The rat MOR tagged with the (His)6-epitope at the N terminus was subcloned in pCDNAmp vector. N2A cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 100 units/ml penicillin, 100 g/ml streptomycin, and 10% fetal calf serum (DMEM growth medium) in a 10% CO2 incubator. These N2A cells were then transfected with 10 g of the (His)6-MOR plasmids. The colonies surviving the antibiotic G418 (Geneticin) selection (1 mg/ml) were isolated. The cell clone that expressed MOR at the level of 0.8 pmol/mg protein was used in receptor complex purification. Cell Culture and Transient Transfection. N2A cells were maintained in DMEM containing 10% fetal bovine serum and penicillin/streptomycin. Cells were plated on 100-mm dishes (for immunoprecipitation studies) or six-well plates (for flow cytometry studies) at a density of 250,000 cells/ml, and grown to 80% confluence. Transfections were performed using the Superfect transfection reagent (QIAGEN, Valencia CA). Transfection medium was replaced with medium containing fresh serum 12 to 18 h after transfection, and cells were harvested 24 to 48 h later. Purification of Receptor Complex and Mass Spectrometry. Sixty 150-mm dishes of stably expressing (His)6-MOR N2A cells and 60 150-mm dishes of control N2A cells were lysed with 1% Triton X-100 at 4°C for 2 h. Lysate was collected and centrifuged at 10,000g for 15 min at 4°C. Supernatant was collected and purified by Ni resin columns (Invitrogen, Carlsbad, CA). Then the columns were washed 10 times with wash buffer and eluted with elution buffer provided by the kit (Invitrogen). Eluates were concentrated with Amicon concentration cells (Millipore, Billerica, MA). Protein was separated by SDS-PAGE and silver-stained, and the presence of MOR was identified by Western analysis. Proteolytic Digestion. Silver-stained gel bands were excised, dried, and destained by incubating in 15 mM K3Fe(CN)6 and 50 mM Na2S2O3 at 24°C for 15 min, and then washed with 100 mM NH4HCO3. Destained gels were dried and rehydrated in 50 mM NH4HCO3 and 5 mM CaCl2 solution with 0.01 mg/ml sequence-grade modified porcine trypsin (Promega, Madison, WI) and incubated at 37°C overnight. Trypsinized fragments were collected by sonicating the gel pieces in 50 l of 25 mM NH4HCO3 and again after adding 50 l of 50% acetonitrile. The supernatant was collected and sonicated repeatedly in 50 l of 5% formic acid and again after adding 50 l of 50% acetonitrile. The supernatant was pooled. DTT was added to a final concentration of 1 mM, and the sample was dried and frozen at 80°C for matrix-assisted laser desorption ionization/time-of-flight spectroscopy or LC MS/MS. LC MS/MS Spectrometry. Before LC MS/MS analysis, the sample was reconstituted with load buffer, and the entire sample was injected. LC MS/MS methods were as described in Kapphahn et al. (2003). LC MS/MS results were analyzed by ProteinPilot Software 2.0, software revision number 50861 (Applied Biosystems, Inc.) (Shilov et al., 2007). The search engine uses biological modification invoked through the search effort (i.e., semiand nontrypsin peptides are included in the search) as the search parameters. Protein Database was NCBI’s nr mouse subset database from musculus_NCBInr_CTM_20061212 and was appended to a contaminants database (107,806 proteins total). Immunoprecipitation and Western Blot Analysis. Confluent cells were washed in phosphate-buffered saline (PBS) at 4°C and lysed for 30 min in solubilization buffer (1% Triton X-100, 150 mM NaCl, and 1 mM EGTA, pH 7.4) containing mammalian protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO) at 4°C. Lysate was centrifuged for 30 min at 10,000g, and the supernatant was collected and assayed for protein by the BCA method (Pierce, Rockford, IL). A total of 500 g of protein was precleared with Protein G Sepharose beads (Sigma-Aldrich) and incubated with 1 g of mouse anti-HA antibodies for 2 to 3 h followed by incubation with 30 l of Protein G Sepharose for 3 h, all at 4°C. Sepharose beads were pelleted by brief centrifugation at 10,000g, at 4°C, and washed three times with solubilization buffer. Proteins were eluted by resuspending in two volumes of 2 SDS-sample buffer (10 mM Tris, 15 mM SDS, 20 mM dithiothreitol, 20% glycerol, and 0.02% bromphenol blue, pH 6.8) followed by incubation at 65°C for 30 min. Proteins were resolved by SDS-PAGE, transferred to Immobilon-P membranes (Millipore Corporation), and immunoblotted with anti-FLAG M2 (Sigma-Aldrich) primary antibodies and detected by anti-mouse alkaline phosphatase-linked secondary antibodies (Bio-Rad Laboratories, Hercules, CA) in Tris-buffered saline containing 5% powdered milk and 0.1% Tween 20, unless indicated otherwise. In Vitro Translation. Each construct was translated in vitro using the TNT Coupled Transcription/Translation System (Promega, Madison, WI) following the company’s protocol. This protocol simplifies in vitro translation by starting with cDNA. The addition of RNA polymerase to the translation mixture eliminated the separate synthesis of RNA from DNA. In brief, the TNT buffer, rabbit reticulocyte lysate, RNA polymerase, amino acid mixture, and RNase inhibitor were added to a 0.5-ml microcentrifuge tube placed on ice. One microgram of plasmid DNA was added to the tube and briefly spun to mix reaction components to the bottom of tube. The reaction was then incubated at 30°C for 90 min. Gel-Overlay Assay. Protein samples were separated by SDSPAGE gel and transferred to Immobilon-P membranes (Millipore Corporation), incubated with in vitro translation product of FLAGRPNI for 1 h at room temperature. The membrane was washed for five min three times at room temperature with Tris-buffered saline/ Tween 20 and immunoblotted with anti-FLAG primary antibodies (Sigma Aldrich). The association of the in vitro-translated product was detected with anti-mouse alkaline phosphatase-linked secondary antibodies (Bio-Rad Laboratories) diluted in Tris-buffered saline containing 5% powdered milk and 0.1% Tween 20. Construct siRNA of RPNI. The GenScript’s siRNA design center siRNA Target Finder and siRNA Construct Builder (http://www. genscript.com/rnai.html) was used to design siRNA sequence for RPNI with following nucleotide sequences: Sense1: GATCCCGTTGTTCTCGTAATGTACTTTGTTGATATCCGCAAAGTACATTACGAGAACAATTTTTTCCAAA; Antisense1, AGCTTTTGGAAAAAATTGTTCTCGTAATGTACTTTGCGGATATCAACAAAGTACATTACGAGAACAACGG; Sense2, GATCCCATCTTCAGTGCATACTGGTCATTGATATCCGTGACCAGTATGCACTGAAGATTTTTTTCCAAA; Antisense2, AGCTTTTGGAAAAAAATCTTCAGTGCATACTGGTCACGGATATCAATGACCAGTATGCACTGAAGATGG; Sense3, GATCCCGTATTGACAGTCTCATCAAAGTTTGATATCCGACTTTGATGAGACTGTCAATATTTTTTCCAAA; Antisense3, AGCTTTTGGAAAAAATATTGACAGTCTCATCAAAGTCGGATATCAAACTTTGATGAGACTGTCAATACGG. Confocal Microscopy. Cells transfected with GFP-tagged vector, GFP-tagged RPNI, and GFP-tagged RPNI siRNA were grown in six-well culture plates on glass coverslips to 60 to 75% confluence and fixed in 3.7% paraformaldehyde for 30 min. Adherent cells were treated with lysis buffer (0.1% Triton X-100, 150 mM NaCl, and 1 1308 Ge et al. at A PE T Jornals on Jne 3, 2017 m oharm .aspeurnals.org D ow nladed from mM EGTA, pH 7.4) for 20 min. Then cells were incubated with mouse anti-HA antibody (1:1000) for 1 h, followed by washing with PBS. Cells then were incubated with goat anti-mouse Alexa Fluor 594 (1:1000). All antibody incubations were performed in PBS with 10% bovine serum albumin. Cells were dried briefly and mounted onto glass slides using Vectashield (Vector Labs, Burlingame, CA). HAtagged MOR was visualized by immunofluorescence, using a CARVII Confocal Imager (BD Biosciences, San Jose, CA) with a Leica DMIRE2 fluorescence microscope (Leica, Wetzlar, Germany). Fluorescence Flow Cytometry. Cells were grown in 12-well culture plates to 80 to 85% confluence. Before the addition of antibodies, cells were rinsed twice with serum-free DMEM. Then the cells were incubated at 4°C for 60 min in serum-free DMEM with anti-HA antibody (1:500). Afterward, the cells were washed twice with serum-free DMEM and incubated with Alexa Fluor 633-labeled goat anti-mouse IgG secondary antibody (1:400) at 4°C for 1 additional hour. Then the cells were washed and fixed with 3.7% formaldehyde before quantifying the receptor immunoreactivity with fluorescence-activated cell sorting (FACScan; BD Biosciences). Fluorescence intensity of 10,000 cells was collected for each sample. CellQuest software (BD Biosciences) was used to calculate the mean fluorescence intensity of the cell population. In our study, two-color flow cytometry was used. A stained nontransfected sample (Mock) was processed with the cytometer to adjust the voltages on forwardand side-scatter detectors for viewing the populations of interest. The R1 region was adjusted around the population. The fluorescent detector voltages were adjusted to place the unstained events in the lower left quadrant. After that, each sample was installed and data were required. Only the cells that transfected with GFP were used to obtain the data on MOR fluorescence. All FACS analyses were conducted three times with triplicate samples in each experiment.